Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01821
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209859
Product ID ORK01821
Clone name ef02131
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DNAJB6
cDNA sequence DNA sequence (8034 bp)
Predicted protein sequence (335 aa)
Flexi ORF Clone FXC01821
Description DnaJ homolog subfamily B member 6 (Heat shock protein J2) (HSJ-2) (MSJ-1) (HHDJ1) (MRJ).
Features of the cloned cDNA sequence

Length: 8034 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6881 bp
Genome contig ID gi89161213f_156722478
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATGCCACCTACATAAATAAAACATAAGCATATTG
Flanking genome sequence
(180412 - 180461)
----+----*----+----*----+----*----+----*----+----*
AATACAGCTCGCCTGCTGTCCTTTGTAAGCGCCAGTAAGTTGCACCGTTA

Features of the protein sequence

Length: 335 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93096 4.7e-125 100.0 DnaJ (Hsp40) ho...
Homo sapiens
BAG11408 1.2e-124 100.0 DnaJ homolog, s...
synthetic construct
XP_001082013 6.5e-119 96.1 similar to DnaJ...
Macaca mulatta
O75190 2.5e-112 93.8 DnaJ homolog su...
Homo sapiens
BAF85714 3.7e-112 93.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001623 4 67 PF00226 Heat shock protein DnaJ
HMMSmart IPR001623 3 62 SM00271 Heat shock protein DnaJ
ProfileScan IPR001623 4 70 PS50076 Heat shock protein DnaJ
ScanRegExp IPR001623 47 66 PS00636 Heat shock protein DnaJ
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp