ORK01825

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01825

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01825
Clone name	ef06366
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MAN1A2
cDNA sequence	DNA sequence (8523 bp) Predicted protein sequence (642 aa)
HaloTag ORF Clone	FHC01825
Flexi ORF Clone	FXC01825
Description	Mannosyl-oligosaccharide 1,2-alpha-mannosidase IB (EC 3.2.1.113) (Processing alpha-1,2-mannosidase IB) (Alpha-1,2-mannosidase IB) (Mannosidase alpha class 1A member 2).

Features of the cloned cDNA sequence

Description

Length: 8523 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5907 bp
Genome contig ID	gi89161185f_117611639
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATATTAAAGTTCAAATAAAGATGTTCTTTAAGTG
Flanking genome sequence (261376 - 261425)	----+--------+--------+--------+--------+----* AAAATTCTTTGTTTAGCCTTCATTTTTACCCGCTGATGACAGTTCAGTTT

Features of the protein sequence

Description

Length: 642 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60476	100.0	Mannosyl-oligos...	Homo sapiens
XP_513685	99.2	mannosidase, al...	Pan troglodytes
XP_001113249	99.0	mannosidase, al...	Macaca mulatta
EAW56676	100.0	mannosidase, al...	Homo sapiens
XP_001144968	99.2	mannosidase, al...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001382	188	208	PR00747	Glycoside hydrolase
	IPR001382	225	239	PR00747	Glycoside hydrolase
	IPR001382	262	280	PR00747	Glycoside hydrolase
	IPR001382	301	320	PR00747	Glycoside hydrolase
	IPR001382	396	413	PR00747	Glycoside hydrolase
	IPR001382	457	473	PR00747	Glycoside hydrolase
	IPR001382	530	554	PR00747	Glycoside hydrolase
	IPR001382	591	611	PR00747	Glycoside hydrolase
HMMPfam	IPR001382	188	627	PF01532	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	36	EKFILLLILSAFITLCFGAFFFL	58	PRIMARY	23