Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01828
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01828
Clone name eg01734
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PPM1A
cDNA sequence DNA sequence (6851 bp)
Predicted protein sequence (397 aa)
Flexi ORF Clone FXC01828
Description protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform
Features of the cloned cDNA sequence

Length: 6851 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 876 bp
Genome contig ID gi51511730f_59714353
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
TATCAATAAAGCTTGATTTAACAAACAAGAAACTT
Flanking genome sequence
(115478 - 115527)
----+----*----+----*----+----*----+----*----+----*
AATCATGTATGTGTAATTCCTCTTTTACCCTGGCCTTTTAAAACACTGTG

Features of the protein sequence

Length: 397 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001167412 4e-173 100.0 hypothetical pr...
Pan troglodytes
NP_808821 4.1e-173 100.0 protein phospha...
Homo sapiens
XP_001167257 9.3e-172 99.2 hypothetical pr...
Pan troglodytes
XP_001497700 1.3e-171 99.2 similar to prot...
Equus caballus
P35813 6e-170 100.0 Protein phospha...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014045 37 299 PF00481 Protein phosphatase 2C
IPR012911 300 379 PF07830 Protein serine/threonine phosphatase 2C
HMMSmart IPR001932 28 304 SM00332 Protein phosphatase 2C-related
ScanRegExp IPR000222 70 78 PS01032 Protein phosphatase 2C
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp