Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01831
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01831
Clone name ek00090
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MAGED1
cDNA sequence DNA sequence (2697 bp)
Predicted protein sequence (792 aa)
Flexi ORF Clone FXC01831
Description Melanoma-associated antigen D1 (MAGE-D1 antigen) (Neurotrophin receptor-interacting MAGE homolog) (MAGE tumor antigen CCF).
Features of the cloned cDNA sequence

Length: 2697 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 215 bp
Genome contig ID gi89161218f_51553483
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTGGTATCAGAAATAAACATTGAAATTGCAAAGTG
Flanking genome sequence
(108707 - 108756)
----+----*----+----*----+----*----+----*----+----*
AATTAGATGTGCTCTCTGCTTCTTTTTTTCCCTATATTTGGGGAGCGAGC

Features of the protein sequence

Length: 792 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y5V3 0 100.0 Melanoma-associ...
Homo sapiens
EAW62896 0 99.8 melanoma antige...
Homo sapiens
AAG09704 0 99.8 NRAGE [Homo sap...
Homo sapiens
AAH14070 0 97.3 Melanoma antige...
Homo sapiens
Q6ITT4 0 92.9 Melanoma-associ...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002190 492 661 PF01454 MAGE protein
ProfileScan IPR002190 485 683 PS50838 MAGE protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp