ORK01835

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01835

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01835
Clone name	fh12212
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh12212 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	VCL
cDNA sequence	DNA sequence (5348 bp) Predicted protein sequence (1096 aa)
HaloTag ORF Clone	FHC01835
Flexi ORF Clone	FXC01835
Description	Vinculin (Metavinculin).

Features of the cloned cDNA sequence

Description

Length: 5348 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1842 bp
Genome contig ID	gi89161187f_75327667
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAATATCAGTGCTCGAGACACAGTGAAGCAAATT
Flanking genome sequence (222110 - 222159)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAATCCCTGAATGATGATTAGAGACATCACCGC

Features of the protein sequence

Description

Length: 1096 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAA61283	100.0	vinculin [Homo ...	Homo sapiens
AAH39174	99.9	Vinculin [Homo ...	Homo sapiens
AAX36196	99.9	vinculin [synth...	synthetic construct
XP_001918196	99.8	vinculin isofor...	Equus caballus
XP_001252035	99.5	similar to vinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006077	886	896	PR00806	Vinculin/alpha-catenin
	IPR006077	901	914	PR00806	Vinculin/alpha-catenin
	IPR006077	947	964	PR00806	Vinculin/alpha-catenin
	IPR006077	982	997	PR00806	Vinculin/alpha-catenin
	IPR006077	997	1012	PR00806	Vinculin/alpha-catenin
	IPR006077	1016	1037	PR00806	Vinculin/alpha-catenin
	IPR006077	1053	1072	PR00806	Vinculin/alpha-catenin
HMMPfam	IPR006077	33	1096	PF01044	Vinculin/alpha-catenin
ScanRegExp	IPR000633	192	212	PS00663	Vinculin
	IPR000633	307	317	PS00664	Vinculin
	IPR000633	418	428	PS00664	Vinculin
	IPR000633	527	537	PS00664	Vinculin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp