Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01843
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01843
Clone name eg01275
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol COL4A2
cDNA sequence DNA sequence (6365 bp)
Predicted protein sequence (1725 aa)
Flexi ORF Clone FXC01843
Description Collagen alpha-2(IV) chain precursor [Contains: Canstatin].
Features of the cloned cDNA sequence

Length: 6365 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 831 bp
Genome contig ID gi51511729f_109657557
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
CGACTACAAAATAAAACTTGGTTCTGAATATTTTT
Flanking genome sequence
(305817 - 305866)		 
----+----*----+----*----+----*----+----*----+----*
AAACCCCGAGTTGTTGACCGCCTTAATCTCGTGTCCATAGAGCAAAACGT

Features of the protein sequence

Length: 1725 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11042 0 100.0 collagen alpha-...
 synthetic construct
P08572 0 99.8 Collagen alpha-...
 Homo sapiens
XP_001136859 0 99.1 alpha 2 type IV...
 Pan troglodytes
XP_509732 0 99.0 alpha 2 type IV...
 Pan troglodytes
P08122 0 83.6 Collagen alpha-...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR008161 324 358 PD000007 Collagen helix repeat
IPR008161 528 560 PD000007 Collagen helix repeat
IPR008161 795 819 PD000007 Collagen helix repeat
IPR008161 860 892 PD000007 Collagen helix repeat
IPR008161 903 933 PD000007 Collagen helix repeat
IPR008161 936 971 PD000007 Collagen helix repeat
IPR008161 1113 1147 PD000007 Collagen helix repeat
IPR008161 1156 1188 PD000007 Collagen helix repeat
IPR008161 1252 1282 PD000007 Collagen helix repeat
IPR008161 1345 1376 PD000007 Collagen helix repeat
IPR008161 1465 1493 PD000007 Collagen helix repeat
IPR001442 1507 1609 PD003923 Type 4 procollagen
IPR001442 1615 1725 PD003923 Type 4 procollagen
HMMPfam IPR008160 80 139 PF01391 Collagen triple helix repeat
IPR008160 140 187 PF01391 Collagen triple helix repeat
IPR008160 196 245 PF01391 Collagen triple helix repeat
IPR008160 306 359 PF01391 Collagen triple helix repeat
IPR008160 372 402 PF01391 Collagen triple helix repeat
IPR008160 436 496 PF01391 Collagen triple helix repeat
IPR008160 506 563 PF01391 Collagen triple helix repeat
IPR008160 569 606 PF01391 Collagen triple helix repeat
IPR008160 637 672 PF01391 Collagen triple helix repeat
IPR008160 697 756 PF01391 Collagen triple helix repeat
IPR008160 757 787 PF01391 Collagen triple helix repeat
IPR008160 873 932 PF01391 Collagen triple helix repeat
IPR008160 933 992 PF01391 Collagen triple helix repeat
IPR008160 1013 1044 PF01391 Collagen triple helix repeat
IPR008160 1046 1103 PF01391 Collagen triple helix repeat
IPR008160 1112 1167 PF01391 Collagen triple helix repeat
IPR008160 1168 1227 PF01391 Collagen triple helix repeat
IPR008160 1251 1282 PF01391 Collagen triple helix repeat
IPR008160 1291 1350 PF01391 Collagen triple helix repeat
IPR008160 1354 1407 PF01391 Collagen triple helix repeat
IPR008160 1430 1489 PF01391 Collagen triple helix repeat
IPR001442 1502 1609 PF01413 Type 4 procollagen
IPR001442 1610 1724 PF01413 Type 4 procollagen
HMMSmart IPR001442 1502 1609 SM00111 Type 4 procollagen
IPR001442 1610 1724 SM00111 Type 4 procollagen
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp