ORK01846

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01846

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01846
Clone name	ej00786
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GTF2I
cDNA sequence	DNA sequence (4474 bp) Predicted protein sequence (1096 aa)
HaloTag ORF Clone	FHC01846
Flexi ORF Clone	FXC01846
Description	General transcription factor II-I (GTFII-I) (TFII-I) (Bruton tyrosine kinase-associated protein 135) (BTK-associated protein 135) (BAP-135) (SRF-Phox1-interacting protein) (SPIN) (Williams-Beuren syndrome chromosome region 6 protein).

Features of the cloned cDNA sequence

Description

Length: 4474 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1160 bp
Genome contig ID	gi89161213f_73610005
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TAATCAATAAAATCCATCCATGCCTTTCACACACT
Flanking genome sequence (202953 - 203002)	----+--------+--------+--------+--------+----* AAGTCATTGCTCTCTCGGCTGTTTTCATGGTCCTGTCTGGGGAAGCTTGG

Features of the protein sequence

Description

Length: 1096 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC08313	100.0	general transcr...	Homo sapiens
BAF85521	99.8	unnamed protein...	Homo sapiens
XP_001151693	98.8	general transcr...	Pan troglodytes
XP_856495	98.6	similar to gene...	Canis lupus fam...
EDL19448	96.0	general transcr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004212	230	305	PF02946	GTF2I-like repeat
	IPR004212	459	534	PF02946	GTF2I-like repeat
	IPR004212	564	639	PF02946	GTF2I-like repeat
	IPR004212	669	744	PF02946	GTF2I-like repeat
	IPR004212	831	906	PF02946	GTF2I-like repeat
	IPR004212	966	1041	PF02946	GTF2I-like repeat
ProfileScan	IPR004212	221	315	PS51139	GTF2I-like repeat
	IPR004212	450	544	PS51139	GTF2I-like repeat
	IPR004212	555	649	PS51139	GTF2I-like repeat
	IPR004212	660	754	PS51139	GTF2I-like repeat
	IPR004212	822	916	PS51139	GTF2I-like repeat
	IPR004212	957	1051	PS51139	GTF2I-like repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp