Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01853
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01853
Clone name ee19916
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PPP4R1
cDNA sequence DNA sequence (3542 bp)
Predicted protein sequence (849 aa)
Flexi ORF Clone FXC01853
Description Serine/threonine-protein phosphatase 4 regulatory subunit 1.
Features of the cloned cDNA sequence

Length: 3542 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 990 bp
Genome contig ID gi51511735r_9436797
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
AAAGTGGGGAAACTAGATTAAAATATTTGTCTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTAGTTTATTAGTTTCTCTGGAATCTGCCTGTGTCCCTGGGTTTGGGT

Features of the protein sequence

Length: 849 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11054 0 100.0 serine/threonin...
synthetic construct
EAX01598 0 87.7 protein phospha...
Homo sapiens
AAD09818 0 86.4 protein serine/...
Homo sapiens
Q8TF05 0 88.3 Serine/threonin...
Homo sapiens
XP_001138009 0 91.1 similar to prot...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 136 172 PF02985 HEAT
IPR000357 675 711 PF02985 HEAT
IPR000357 759 795 PF02985 HEAT
ProfileScan IPR000357 142 180 PS50077 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp