Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01892
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01892
Clone name af12018
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ELMSAN1
cDNA sequence DNA sequence (7415 bp)
Predicted protein sequence (1111 aa)
Flexi ORF Clone FXC01892
Description Uncharacterized protein C14orf43.
Features of the cloned cDNA sequence

Length: 7415 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3562 bp
Genome contig ID gi51511730r_73151580
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
CTTTAAACCTTTTATTAAATAAGGTTTTAAAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAGAGTTGAATGCTTTGTTCTCTTGGGATTTTCACCATCTGGGGTTGATG

Features of the protein sequence

Length: 1111 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11085 0 100.0 C14orf43 protei...
synthetic construct
XP_510053 0 99.6 hypothetical pr...
Pan troglodytes
XP_001086211 0 97.0 similar to tran...
Macaca mulatta
Q6PJG2 0 99.9 Uncharacterized...
Homo sapiens
AAH06511 0 99.9 C14orf43 protei...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000949 733 798 PF01448 ELM2
IPR014778 842 887 PF00249 Myb
IPR007087 1050 1072 PF00096 Zinc finger
HMMSmart IPR001005 841 889 SM00717 SANT
ProfileScan IPR000949 733 825 PS51156 ELM2
IPR007087 1050 1077 PS50157 Zinc finger
ScanRegExp IPR007087 1052 1072 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp