ORK01895

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01895

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01895
Clone name	bm00618
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	H1F0
cDNA sequence	DNA sequence (2166 bp) Predicted protein sequence (287 aa)
HaloTag ORF Clone	FHC01895
Flexi ORF Clone	FXC01895
Description	Histone H1.0 (Histone H1(0)) (Histone H1').

Features of the cloned cDNA sequence

Description

Length: 2166 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1300 bp
Genome contig ID	gi89161203f_36431224
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATTTTAAAACTTTAAAATAAATTGGAAAAGGGAG
Flanking genome sequence (102160 - 102209)	----+--------+--------+--------+--------+----* AAACTGAGCGGTGTATTTTTCCTCACTTTGAAGACTGGAGAATGAATGCG

Features of the protein sequence

Description

Length: 287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P07305	2.5e-49	100.0	Histone H1.0; H...	Homo sapiens
AAV38225	2.5e-49	100.0	H1 histone fami...	synthetic construct
Q5NVN9	2.8e-49	99.4	Histone H1.0; H...	Pongo abelii
XP_001089028	4.3e-49	99.4	H1 histone fami...	Macaca mulatta
AAV38226	4.3e-49	99.4	H1 histone fami...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003216	117	169	PD000373	Linker histone
FPrintScan	IPR005819	104	125	PR00624	Histone H5
	IPR005819	131	148	PR00624	Histone H5
	IPR005819	151	169	PR00624	Histone H5
	IPR005819	172	196	PR00624	Histone H5
	IPR005819	208	222	PR00624	Histone H5
	IPR005819	242	259	PR00624	Histone H5
	IPR005819	264	283	PR00624	Histone H5
HMMPfam	IPR005818	117	190	PF00538	Histone H1/H5
HMMSmart	IPR005818	115	180	SM00526	Histone H1/H5

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp