Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01896
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01896
Clone name bm01286
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol UIMC1
cDNA sequence DNA sequence (1806 bp)
Predicted protein sequence (349 aa)
Flexi ORF Clone FXC01896
Description Ubiquitin interaction motif-containing protein 1 (Retinoid X receptor- interacting protein 110) (Receptor-associated protein 80) (Nuclear zinc finger protein RAP80).
Features of the cloned cDNA sequence

Length: 1806 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 231 bp
Genome contig ID gi51511721r_176164658
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTTTGAATTTACTTACAGTTAAAAAATTTAAATAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTATGTTTGTACGAAATCTTATTTCAATAGATGGAAATTTTAATTTTT

Features of the protein sequence

Length: 349 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11089 3.8e-139 100.0 ubiquitin inter...
synthetic construct
AAF14875 1e-137 98.2 retinoid x rece...
Homo sapiens
AAG59855 2.8e-136 97.7 X2HRIP110 [Homo...
Homo sapiens
XP_001137523 1.3e-132 95.4 similar to reti...
Pan troglodytes
EAW85041 2.1e-124 97.8 receptor associ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp