Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01899
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01899
Clone name ee04147
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AFF1
cDNA sequence DNA sequence (9099 bp)
Predicted protein sequence (1212 aa)
Flexi ORF Clone FXC01899
Description AF4/FMR2 family member 1 (Protein AF-4) (Proto-oncogene AF4) (Protein FEL).
Features of the cloned cDNA sequence

Length: 9099 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5339 bp
Genome contig ID gi89161207f_88047460
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAAAACAAAAAAATTAATAAAAATTTCGAGAAATC
Flanking genome sequence
(233756 - 233805)
----+----*----+----*----+----*----+----*----+----*
ATTGGGGTTGAATCCATGCTTTCTCTTTACCTGAATACAGTTAATTCCTA

Features of the protein sequence

Length: 1212 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI14931 0 100.0 AF4/FMR2 family...
Homo sapiens
CAB69660 0 99.9 AF-4 [Homo sapi...
Homo sapiens
P51825 0 99.9 AF4/FMR2 family...
Homo sapiens
XP_001156948 0 98.8 myeloid/lymphoi...
Pan troglodytes
XP_517328 0 98.3 myeloid/lymphoi...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007797 9 1210 PF05110 AF-4 proto-oncoprotein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp