Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01905
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01905
Clone name eh00686
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PTPN14
cDNA sequence DNA sequence (6054 bp)
Predicted protein sequence (1216 aa)
Flexi ORF Clone FXC01905
Description Tyrosine-protein phosphatase non-receptor type 14 (EC 3.1.3.48) (Protein-tyrosine phosphatase pez).
Features of the cloned cDNA sequence

Length: 6054 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1943 bp
Genome contig ID gi89161185r_212496225
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAGTCCAGGCTGGGCTACGGAGAGACCCTGCCTCC
Flanking genome sequence
(99719 - 99670)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGGAAAAAAGGTTGTCAAGAAAAACTAGATGTT

Features of the protein sequence

Length: 1216 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH73027 0 100.0 protein tyrosin...
 Homo sapiens
BAF84330 0 99.9 unnamed protein...
 Homo sapiens
Q15678 0 99.9 Tyrosine-protei...
 Homo sapiens
XP_001171329 0 99.6 protein tyrosin...
 Pan troglodytes
XP_001106167 0 98.9 similar to prot...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000299 83 95 PR00935 Band 4.1
IPR000299 149 162 PR00935 Band 4.1
IPR000299 162 182 PR00935 Band 4.1
IPR000299 229 245 PR00935 Band 4.1
IPR000242 990 997 PR00700 Protein-tyrosine phosphatase
IPR000242 1008 1028 PR00700 Protein-tyrosine phosphatase
IPR000242 1096 1113 PR00700 Protein-tyrosine phosphatase
IPR000242 1145 1163 PR00700 Protein-tyrosine phosphatase
IPR000242 1176 1191 PR00700 Protein-tyrosine phosphatase
IPR000242 1192 1202 PR00700 Protein-tyrosine phosphatase
HMMPfam IPR000299 52 249 PF00373 Band 4.1
IPR000242 962 1208 PF00102 Protein-tyrosine phosphatase
HMMSmart IPR000299 46 249 SM00295 Band 4.1
IPR000242 937 1211 SM00194 Protein-tyrosine phosphatase
IPR003595 1097 1208 SM00404 Protein-tyrosine phosphatase
ProfileScan IPR000299 50 335 PS50057 Band 4.1
IPR000242 938 1209 PS50055 Protein-tyrosine phosphatase
IPR000387 1119 1200 PS50056 Protein-tyrosine phosphatase
ScanRegExp IPR000299 104 134 PS00660 Band 4.1
IPR000299 219 248 PS00661 Band 4.1
IPR000387 1148 1160 PS00383 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp