Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01914
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01914
Clone name ha01907
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol EIF4B
cDNA sequence DNA sequence (3854 bp)
Predicted protein sequence (616 aa)
Flexi ORF Clone FXC01914
Description Eukaryotic translation initiation factor 4B (eIF-4B).
Features of the cloned cDNA sequence

Length: 3854 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2002 bp
Genome contig ID gi89161190f_51596521
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAATCTGATCTTTAAAGTTCAGATTTATTTGGAG
Flanking genome sequence None

Features of the protein sequence

Length: 616 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB82380 8.2e-183 100.0 eukaryotic init...
Homo sapiens
CAG33239 1.2e-182 99.8 EIF4B [Homo sap...
Homo sapiens
AAH73154 1.7e-182 99.8 Eukaryotic tran...
Homo sapiens
BAD96248 1.7e-182 99.6 eukaryotic tran...
Homo sapiens
AAH98437 2.6e-182 99.8 Eukaryotic tran...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 103 173 PF00076 RNA recognition motif
HMMSmart IPR000504 102 174 SM00360 RNA recognition motif
ProfileScan IPR000504 101 178 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp