ORK01986

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01986

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01986
Clone name	fg03084
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGAP26
cDNA sequence	DNA sequence (6552 bp) Predicted protein sequence (829 aa)
HaloTag ORF Clone	FHC01986
Flexi ORF Clone	FXC01986
Description	Rho GTPase-activating protein 26 (Oligophrenin-1-like protein) (GTPase regulator associated with focal adhesion kinase).

Features of the cloned cDNA sequence

Description

Length: 6552 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4039 bp
Genome contig ID	gi51511721f_142030167
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCTGGGTGACAGAGCCAGACTCCGTCTCAAAGG
Flanking genome sequence (556078 - 556127)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAATGCCATGCCAGGAGAAGACAGCTGGT

Features of the protein sequence

Description

Length: 829 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_535224	82.5	similar to Rho-...	Canis lupus fam...
XP_001917752	85.4	similar to ARHG...	Equus caballus
AAH68555	95.1	ARHGAP26 protei...	Homo sapiens
Q9UNA1	88.6	Rho GTPase-acti...	Homo sapiens
CAA71414	94.9	Graf protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	776	827	PD000066	Src homology-3
FPrintScan	IPR001452	788	803	PR00452	Src homology-3
FPrintScan	IPR001452	817	829	PR00452	Src homology-3
HMMPfam	IPR001849	373	476	PF00169	Pleckstrin-like
	IPR000198	498	654	PF00620	RhoGAP
	IPR001452	774	829	PF00018	Src homology-3
HMMSmart	IPR001849	373	478	SM00233	Pleckstrin-like
	IPR000198	494	672	SM00324	RhoGAP
	IPR001452	774	829	SM00326	Src homology-3
ProfileScan	IPR001849	372	476	PS50003	Pleckstrin-like
	IPR000198	490	675	PS50238	RhoGAP
	IPR001452	771	829	PS50002	Src homology-3
ScanRegExp	IPR003006	780	786	PS00290	Immunoglobulin/major histocompatibility complex motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp