Length: 5687 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
2144 bp |
Genome contig ID |
gi89161190r_128022224 |
PolyA signal sequence (TATAAA,-22) |
+----*----+----*----+----*----+---- TACTGACTGTAAATATAAAGTTTGCATTCAGTGGC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* TTTATGGCTGTCCTTTGTCTTCTACACGCTGACCCCCTCCAAGGGGCTGG |
Length: 1120 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q14C87 |
0 |
100.0 |
Transmembrane p...
|
Homo sapiens
|
BAC97794 |
0 |
99.9 |
HBE120 [Homo sa...
|
Homo sapiens
|
AAI14627 |
0 |
99.9 |
TMEM132D protei...
|
Homo sapiens
|
XP_001916304 |
0 |
87.8 |
similar to TMEM...
|
Equus caballus
|
EDL19538 |
0 |
82.5 |
transmembrane p...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
30 |
LWHHWSPVLISLAALFSKVTEGR |
52 |
SECONDARY |
23 |
2 |
941 |
MYALLGVFCLAILVFLINCVTFA |
963 |
PRIMARY |
23 |