ORK02060

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02060

Order Kazusa clone(s) from :

Accession No	AB290167
Product ID	ORK02060
Clone name	bj00195y2
Vector information	The cDNA fragment was inserted at the SalI-SacI site of of ... The cDNA fragment was inserted at the SalI-SacI site of of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5'/3' end of the cDNA is as follows: 5'-end: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CG-5' end of cDNA 3'-end: GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGTT TTTTTTTTTT TTTTTT-3' end of cDNA
Symbol	DYNC2H1
cDNA sequence	DNA sequence (13492 bp) Predicted protein sequence (4361 aa)
HaloTag ORF Clone	FHC02060
Flexi ORF Clone	FXC02060
Description	dynein, cytoplasmic 2, heavy chain 1

Features of the cloned cDNA sequence

Description

Length: 13492 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	370 bp
Genome contig ID	gi51511727f_102385387
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCATAATTATTTAATAAAAGAGCATTCATAATT
Flanking genome sequence (470176 - 470225)	----+--------+--------+--------+--------+----* TTTGCAGTCTTCCCATGACTCTTTTTACATACTGAAGAATGTATTATAAA

Features of the protein sequence

Description

Length: 4361 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06721	100.0	DYNC2H1 variant...	Homo sapiens
Q8NCM8	99.9	Cytoplasmic dyn...	Homo sapiens
NP_001073932	99.7	cytoplasmic dyn...	Homo sapiens
XP_589775	93.2	similar to dyne...	Bos taurus
Q45VK7	93.2	Cytoplasmic dyn...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	188	730	PF08385	Dynein heavy chain
	IPR013602	1169	1577	PF08393	Dynein heavy chain
	IPR011704	1741	1874	PF07728	ATPase associated with various cellular activities
	IPR011704	2028	2172	PF07728	ATPase associated with various cellular activities
	IPR004273	3661	4359	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1738	1884	SM00382	AAA+ ATPase
	IPR003593	2025	2181	SM00382	AAA+ ATPase
	IPR003593	2337	2485	SM00382	AAA+ ATPase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp