ORK02063

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02063

Order Kazusa clone(s) from :

Accession No	AB210026
Product ID	ORK02063
Clone name	hf00991
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYH10
cDNA sequence	DNA sequence (7693 bp) Predicted protein sequence (2018 aa)
HaloTag ORF Clone	FHC02063
Flexi ORF Clone	FXC02063
Description	Myosin-10 (Myosin heavy chain 10) (Myosin heavy chain, nonmuscle IIb) (Nonmuscle myosin heavy chain IIb) (NMMHC II-b) (NMMHC-IIB) (Cellular myosin heavy chain, type B) (Nonmuscle myosin heavy chain-B) (NMMHC- B).

Features of the cloned cDNA sequence

Description

Length: 7693 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1578 bp
Genome contig ID	gi51511734r_8218269
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- CACCCGTGGAGAATAAAGAGACCTCAATAAACAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAATCATGTGAACGTGGAATCTGTTTTCTCACCTTCTGTTCTCGATTT

Features of the protein sequence

Description

Length: 2018 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06108	100.0	MYH10 variant p...	Homo sapiens
XP_511852	100.0	myosin, heavy p...	Pan troglodytes
XP_850098	98.9	similar to myos...	Canis lupus fam...
CAI25527	99.0	myosin, heavy p...	Mus musculus
AAA48988	95.7	nonmuscle myosi...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	236	271	PD000355	Myosin head
BlastProDom	NULL	1551	1716	PD023692	NULL
FPrintScan	IPR001609	126	145	PR00193	Myosin head
	IPR001609	182	207	PR00193	Myosin head
	IPR001609	244	271	PR00193	Myosin head
	IPR001609	475	503	PR00193	Myosin head
	IPR001609	529	557	PR00193	Myosin head
HMMPfam	IPR004009	44	86	PF02736	Myosin
	IPR001609	98	813	PF00063	Myosin head
	IPR000048	829	849	PF00612	IQ calmodulin-binding region
	IPR002928	1115	1972	PF01576	Myosin tail
HMMSmart	IPR001609	90	826	SM00242	Myosin head
HMMSmart	IPR000048	827	849	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	828	857	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp