Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02067
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02067
Clone name ah06551
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SYNRG
cDNA sequence DNA sequence (6167 bp)
Predicted protein sequence (1301 aa)
Flexi ORF Clone FXC02067
Description AP1 subunit gamma-binding protein 1 (Gamma-synergin).
Features of the cloned cDNA sequence

Length: 6167 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2260 bp
Genome contig ID gi51511734r_32851099
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCGTAGGTGATGACAGAGCGAGACACTGTCTCTT
Flanking genome sequence
(99797 - 99748)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGTTTCCCAGTTTGAATTTGTATTGCTGAAGCA

Features of the protein sequence

Length: 1301 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW57595 0 100.0 AP1 gamma subun...
Homo sapiens
NP_542117 0 99.9 synergin gamma ...
Homo sapiens
XP_511432 0 99.6 AP1 gamma subun...
Pan troglodytes
EAW57597 0 99.0 AP1 gamma subun...
Homo sapiens
Q9UMZ2 0 99.0 Synergin gamma;...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR000261 295 382 SM00027 EPS15 homology (EH)
ProfileScan IPR000261 294 376 PS50031 EPS15 homology (EH)
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp