ORK02068

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02068

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02068
Clone name	sh02236
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SCAF11
cDNA sequence	DNA sequence (5456 bp) Predicted protein sequence (1468 aa)
HaloTag ORF Clone	FHC02068
Flexi ORF Clone	FXC02068
Description	SFRS2-interacting protein (Splicing factor, arginine/serine-rich 2- interacting protein) (SC35-interacting protein 1) (CTD-associated SR protein 11) (Splicing regulatory protein 129) (SRrp129) (Renal carcinoma antigen NY-REN-40).

Features of the cloned cDNA sequence

Description

Length: 5456 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1048 bp
Genome contig ID	gi89161190r_44501332
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAGGAGCAAATCTCCGTCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAGAAAAAAAAAAGTGTTGACTTTGTAGAAATTATGTTCTTTCA

Features of the protein sequence

Description

Length: 1468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW57894	99.8	splicing factor...	Homo sapiens
XP_001165201	98.9	splicing factor...	Pan troglodytes
EAW57893	98.7	splicing factor...	Homo sapiens
XP_509017	98.2	splicing factor...	Pan troglodytes
XP_001164921	98.9	splicing factor...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001841	46	86	SM00184	Zinc finger
ProfileScan	IPR001841	46	87	PS50089	Zinc finger
ScanRegExp	IPR001841	64	73	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp