ORK02069

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02069

Order Kazusa clone(s) from :

Accession No	AB210021
Product ID	ORK02069
Clone name	fk11093
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDR1
cDNA sequence	DNA sequence (3641 bp) Predicted protein sequence (894 aa)
HaloTag ORF Clone	FHC02069
Flexi ORF Clone	FXC02069
Description	Epithelial discoidin domain-containing receptor 1 precursor (EC 2.7.10.1) (Epithelial discoidin domain receptor 1) (Tyrosine kinase DDR) (Discoidin receptor tyrosine kinase) (Tyrosine-protein kinase CAK) (Cell adhesion kinase) (TRK E) (Protein-tyrosine ki

Features of the cloned cDNA sequence

Description

Length: 3641 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	856 bp
Genome contig ID	gi89161210f_30860411
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCACTAGGCAGGTAATAATAAAGGTTGAGTTTTCC
Flanking genome sequence (115499 - 115548)	----+--------+--------+--------+--------+----* ACAACTGTGTGAGTGGGTTCCTTGGGAATTTGGTAACTCTGCCTCCTGCA

Features of the protein sequence

Description

Length: 894 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06103	100.0	DDR1 variant pr...	Homo sapiens
CAA52915	100.0	TrkE [Homo sapi...	Homo sapiens
AAQ02613	100.0	discoidin domai...	synthetic construct
AAP36894	100.0	discoidin domai...	synthetic construct
AAH70070	99.7	DDR1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	597	879	PD000001	Protein kinase
FPrintScan	IPR001245	682	695	PR00109	Tyrosine protein kinase
	IPR001245	737	755	PR00109	Tyrosine protein kinase
	IPR001245	786	796	PR00109	Tyrosine protein kinase
	IPR001245	805	827	PR00109	Tyrosine protein kinase
HMMPfam	IPR000421	64	200	PF00754	Coagulation factor 5/8 type
HMMPfam	IPR001245	591	886	PF07714	Tyrosine protein kinase
HMMSmart	IPR000421	48	203	SM00231	Coagulation factor 5/8 type
	IPR001245	591	886	SM00219	Tyrosine protein kinase
	IPR002290	591	886	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000421	49	203	PS50022	Coagulation factor 5/8 type
ProfileScan	IPR000719	591	886	PS50011	Protein kinase
ScanRegExp	IPR000421	90	122	PS01285	Coagulation factor 5/8 type
	IPR000421	186	203	PS01286	Coagulation factor 5/8 type
	IPR008266	743	755	PS00109	Tyrosine protein kinase
	IPR002011	771	779	PS00239	Receptor tyrosine kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	SGAMGPEALSSLLLLLLVAS	35	SECONDARY	20
SOSUI2	2	434	TAILIGCLVAIILLLLLIIALML	456	PRIMARY	23