ORK02103

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02103

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02103
Clone name	hj02742
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RASSF7
cDNA sequence	DNA sequence (5073 bp) Predicted protein sequence (382 aa)
HaloTag ORF Clone	FHC02103
Flexi ORF Clone	FXC02103
Description	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7

Features of the cloned cDNA sequence

Description

Length: 5073 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	373 bp
Genome contig ID	gi51511727f_445988
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCCCAACGTGAAAACCTCAATAAACTGCCCGAAGC
Flanking genome sequence (108032 - 108081)	----+--------+--------+--------+--------+----* AGCTTGAGTGTGTGTGGAGGCTGCGCTGGGCAGGGTCTGAGGTCTTGAAC

Features of the protein sequence

Description

Length: 382 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q02833	3.7e-116	100.0	Ras association...	Homo sapiens
XP_001145762	7.1e-115	99.1	Ras association...	Pan troglodytes
XP_001145966	2.8e-105	93.8	Ras association...	Pan troglodytes
EAX02351	8e-97	99.6	Ras association...	Homo sapiens
EAX02349	1.9e-96	100.0	Ras association...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	15	98	PF00788	Ras-association
HMMSmart	IPR000159	15	98	SM00314	Ras-association
ProfileScan	IPR000159	15	98	PS50200	Ras-association

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp