ORK02106

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02106

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02106
Clone name	hk00294
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADD1
cDNA sequence	DNA sequence (4045 bp) Predicted protein sequence (772 aa)
HaloTag ORF Clone	FHC02106
Flexi ORF Clone	FXC02106
Description	Alpha-adducin (Erythrocyte adducin subunit alpha).

Features of the cloned cDNA sequence

Description

Length: 4045 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1537 bp
Genome contig ID	gi89161207f_2715369
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAACATGTTTTACTCACAAATAAAATTCTTTCAGC
Flanking genome sequence (186218 - 186267)	----+--------+--------+--------+--------+----* AAGTTCCTTGTCTAAATCTGGGAAGCAGTTTTATATTTTAATTTCTTTGT

Features of the protein sequence

Description

Length: 772 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW82501	100.0	adducin 1 (alph...	Homo sapiens
XP_001151173	99.6	adducin 1 (alph...	Pan troglodytes
XP_001088796	99.2	adducin 1 (alph...	Macaca mulatta
XP_001088457	96.4	adducin 1 (alph...	Macaca mulatta
XP_001489624	94.3	adducin 1 (alph...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001303	151	350	PF00596	Class II aldolase/adducin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp