Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02110
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209105
Product ID ORK02110
Clone name hh05661
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HAP1
cDNA sequence DNA sequence (5667 bp)
Predicted protein sequence (593 aa)
Flexi ORF Clone FXC02110
Description Huntingtin-associated protein 1 (HAP-1) (Neuroan 1).
Features of the cloned cDNA sequence

Length: 5667 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3885 bp
Genome contig ID gi51511734r_37030960
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCCTGGGCAATAAGAGTGAAACTCCGTCTCAAGG
Flanking genome sequence
(99631 - 99582)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAATATATCTCAGAGTTATCCCACCCCTTGGGTGGG

Features of the protein sequence

Length: 593 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92342 8.9e-181 100.0 huntingtin-asso...
Homo sapiens
NP_001073340 7.3e-180 99.3 huntingtin-asso...
Homo sapiens
EAW60761 1.6e-179 98.6 huntingtin-asso...
Homo sapiens
NP_001073339 1.3e-178 98.0 huntingtin-asso...
Homo sapiens
BAB13952 1.5e-178 98.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006933 105 449 PF04849 HAP1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp