ORK02189

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02189

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02189
Clone name	bm04489
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DNAJB1
cDNA sequence	DNA sequence (2223 bp) Predicted protein sequence (350 aa)
HaloTag ORF Clone	FHC02189
Flexi ORF Clone	FXC02189
Description	DnaJ homolog subfamily B member 1 (Heat shock 40 kDa protein 1) (Heat shock protein 40) (HSP40) (DnaJ protein homolog 1) (HDJ-1).

Features of the cloned cDNA sequence

Description

Length: 2223 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1170 bp
Genome contig ID	gi42406306r_14386582
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AAGTGCGACAGCATTAAAGACTGATGCTAAACCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGGGAGCGGTCCTGTGACTCTGTTTGAGGGTTCTGCTGGTTTTGGGGGT

Features of the protein sequence

Description

Length: 350 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P25685	2e-133	100.0	DnaJ homolog su...	Homo sapiens
AAX37112	2e-133	100.0	DnaJ-like subfa...	synthetic construct
CAG38724	6.1e-133	99.7	DNAJB1 [Homo sa...	Homo sapiens
XP_524134	4.4e-132	99.1	DnaJ (Hsp40) ho...	Pan troglodytes
Q3MI00	3.1e-131	97.9	DnaJ homolog su...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003095	25	44	PR00625	Heat shock protein DnaJ
	IPR003095	55	75	PR00625	Heat shock protein DnaJ
	IPR003095	216	232	PR00625	Heat shock protein DnaJ
	IPR003095	261	278	PR00625	Heat shock protein DnaJ
HMMPfam	IPR001623	14	75	PF00226	Heat shock protein DnaJ
HMMPfam	IPR002939	226	348	PF01556	Chaperone DnaJ
HMMSmart	IPR001623	13	70	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	14	78	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR001623	55	74	PS00636	Heat shock protein DnaJ

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp