Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02200
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02200
Clone name ef00872
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZSCAN26
cDNA sequence DNA sequence (2644 bp)
Predicted protein sequence (497 aa)
Flexi ORF Clone FXC02200
Description zinc finger protein 187
Features of the cloned cDNA sequence

Length: 2644 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1105 bp
Genome contig ID gi89161210f_28247609
PolyA signal sequence
(AATAAA,-16)		 
+----*----+----*----+----*----+----
TAGAATACTGTTTCCTTCTAATAAAGGTTTCAAAC
Flanking genome sequence
(106350 - 106399)		 
----+----*----+----*----+----*----+----*----+----*
AAATCCCTGCAGATTTATTTAAAGTGTTTGTGGAAGATAATTTTCCATAT

Features of the protein sequence

Length: 497 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX03147 2.9e-191 100.0 zinc finger pro...
 Homo sapiens
Q16670 3e-190 99.7 Zinc finger pro...
 Homo sapiens
XP_001141324 1.2e-189 99.1 zinc finger pro...
 Pan troglodytes
XP_001140912 1.9e-176 99.1 zinc finger pro...
 Pan troglodytes
CAA77818 8.5e-162 99.5 SRE-ZBP [Homo s...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 301 323 PD000003 Zinc finger
IPR007087 329 352 PD000003 Zinc finger
IPR007087 357 380 PD000003 Zinc finger
IPR007087 386 408 PD000003 Zinc finger
IPR007087 413 436 PD000003 Zinc finger
IPR007087 441 463 PD000003 Zinc finger
IPR007087 469 492 PD000003 Zinc finger
HMMPfam IPR003309 63 158 PF02023 Transcriptional regulator SCAN
IPR007087 301 323 PF00096 Zinc finger
IPR007087 329 351 PF00096 Zinc finger
IPR007087 357 379 PF00096 Zinc finger
IPR007087 385 407 PF00096 Zinc finger
IPR007087 413 435 PF00096 Zinc finger
IPR007087 441 463 PF00096 Zinc finger
IPR007087 469 491 PF00096 Zinc finger
HMMSmart IPR003309 65 178 SM00431 Transcriptional regulator SCAN
IPR015880 250 272 SM00355 Zinc finger
IPR015880 301 323 SM00355 Zinc finger
IPR015880 329 351 SM00355 Zinc finger
IPR015880 357 379 SM00355 Zinc finger
IPR015880 385 407 SM00355 Zinc finger
IPR015880 413 435 SM00355 Zinc finger
IPR015880 441 463 SM00355 Zinc finger
IPR015880 469 491 SM00355 Zinc finger
ProfileScan IPR003309 70 151 PS50804 Transcriptional regulator SCAN
IPR007087 250 277 PS50157 Zinc finger
IPR007087 301 328 PS50157 Zinc finger
IPR007087 329 356 PS50157 Zinc finger
IPR007087 357 384 PS50157 Zinc finger
IPR007087 385 412 PS50157 Zinc finger
IPR007087 413 440 PS50157 Zinc finger
IPR007087 441 468 PS50157 Zinc finger
IPR007087 469 496 PS50157 Zinc finger
ScanRegExp IPR007087 303 323 PS00028 Zinc finger
IPR007087 331 351 PS00028 Zinc finger
IPR007087 359 379 PS00028 Zinc finger
IPR007087 385 409 PS00028 Zinc finger
IPR007087 415 435 PS00028 Zinc finger
IPR007087 443 463 PS00028 Zinc finger
IPR007087 471 492 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp