Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02212
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209914
Product ID ORK02212
Clone name ej00605
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LGALS8
cDNA sequence DNA sequence (3895 bp)
Predicted protein sequence (338 aa)
Flexi ORF Clone FXC02212
Description Galectin-8 (Gal-8) (Prostate carcinoma tumor antigen 1) (PCTA-1) (Po66 carbohydrate-binding protein) (Po66-CBP).
Features of the cloned cDNA sequence

Length: 3895 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2827 bp
Genome contig ID gi89161185f_234655890
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTGGCACTGATGTTCTACTTCTTCACATTCATCT
Flanking genome sequence
(125027 - 125076)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAATCAAAATTAAAATCTGAGTCAGTCCGCCTGCC

Features of the protein sequence

Length: 338 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93151 7.1e-141 100.0 Galectin-8 vari...
Homo sapiens
AAF19370 2.1e-131 100.0 galectin-8 [Hom...
Homo sapiens
O00214 6.2e-131 100.0 Galectin-8; Sho...
Homo sapiens
EAW70055 1.3e-129 99.0 lectin, galacto...
Homo sapiens
AAK16735 2.4e-129 98.7 colorectal carc...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001079 39 172 PF00337 Galectin
IPR001079 207 337 PF00337 Galectin
HMMSmart IPR001079 38 173 SM00276 Galectin
IPR001079 206 338 SM00276 Galectin
ScanRegExp IPR001079 270 290 PS00309 Galectin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp