ORK02218

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02218

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02218
Clone name	pf01683
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP1B
cDNA sequence	DNA sequence (7837 bp) Predicted protein sequence (2483 aa)
HaloTag ORF Clone	FHC02218
Flexi ORF Clone	FXC02218
Description	Microtubule-associated protein 1B (MAP 1B) [Contains: MAP1 light chain LC1].

Features of the cloned cDNA sequence

Description

Length: 7837 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	385 bp
Genome contig ID	gi51511721f_71339070
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAGAGCACAAAGATAACGCAGGAGAGAGAGAGAG
Flanking genome sequence (198139 - 198188)	----+--------+--------+--------+--------+----* AAAGAATGAGAAAGAAAAGGAATGCAAGAGAAGGAGATGTAATGACAGAG

Features of the protein sequence

Description

Length: 2483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_005900	100.0	microtubule-ass...	Homo sapiens
P46821	99.9	Microtubule-ass...	Homo sapiens
EAW95696	99.9	microtubule-ass...	Homo sapiens
XP_517716	99.0	microtubule-ass...	Pan troglodytes
XP_001918385	91.9	similar to Micr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000102	1893	1909	PF00414	Neuraxin/MAP1B repeat
	IPR000102	1910	1926	PF00414	Neuraxin/MAP1B repeat
	IPR000102	1927	1943	PF00414	Neuraxin/MAP1B repeat
	IPR000102	1944	1960	PF00414	Neuraxin/MAP1B repeat
	IPR000102	1961	1977	PF00414	Neuraxin/MAP1B repeat
	IPR000102	1978	1994	PF00414	Neuraxin/MAP1B repeat
	IPR000102	2012	2028	PF00414	Neuraxin/MAP1B repeat
	IPR000102	2029	2045	PF00414	Neuraxin/MAP1B repeat
	IPR000102	2046	2062	PF00414	Neuraxin/MAP1B repeat
	IPR000102	2063	2079	PF00414	Neuraxin/MAP1B repeat
ScanRegExp	IPR000102	1901	1910	PS00230	Neuraxin/MAP1B repeat
	IPR000102	1918	1927	PS00230	Neuraxin/MAP1B repeat
	IPR000102	1952	1961	PS00230	Neuraxin/MAP1B repeat
	IPR000102	1986	1995	PS00230	Neuraxin/MAP1B repeat
	IPR000102	2020	2029	PS00230	Neuraxin/MAP1B repeat
	IPR000102	2054	2063	PS00230	Neuraxin/MAP1B repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp