ORK02366

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02366

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02366
Clone name	bm02647
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ANP32A
cDNA sequence	DNA sequence (1955 bp) Predicted protein sequence (260 aa)
HaloTag ORF Clone	FHC02366
Flexi ORF Clone	FXC02366
Description	Acidic leucine-rich nuclear phosphoprotein 32 family member A (Potent heat-stable protein phosphatase 2A inhibitor I1PP2A) (Acidic nuclear phosphoprotein pp32) (Leucine-rich acidic nuclear protein) (Lanp) (Putative HLA-DR-associated protein I) (PHAPI) (Ma

Features of the cloned cDNA sequence

Description

Length: 1955 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1171 bp
Genome contig ID	gi51511731r_66758302
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTGTCATTGATAAATTTCAATAAATCTTTTTATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTTTTGGGGATGGCTTCTTTGAGTCCAACAGGCCATTGATCTTTTC

Features of the protein sequence

Description

Length: 260 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P39687	4.3e-73	100.0	Acidic leucine-...	Homo sapiens
BAD97000	7.6e-73	99.5	acidic (leucine...	Homo sapiens
AAY18916	1e-72	100.0	cerebellar leuc...	synthetic construct
XP_001084434	3.4e-72	98.4	similar to acid...	Macaca mulatta
P51122	3.4e-71	96.3	Acidic leucine-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	77	90	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	98	111	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	76	98	PF00560	Leucine-rich repeat
HMMPfam	IPR001611	100	123	PF00560	Leucine-rich repeat
HMMSmart	IPR003603	139	157	SM00446	U2A'/phosphoprotein 32 family A

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp