Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02367
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02367
Clone name ef04086
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol WDR45B
cDNA sequence DNA sequence (2453 bp)
Predicted protein sequence (353 aa)
Flexi ORF Clone FXC02367
Description WD repeat domain phosphoinositide-interacting protein 3 (WIPI-3) (WD repeat protein 45-like) (WDR45-like protein) (WIPI49-like protein).
Features of the cloned cDNA sequence

Length: 2453 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1336 bp
Genome contig ID gi51511734r_78065747
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTAATGTTTCTTTTAAATAAAAGTGACTAATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTTGTAGTCTGGACCTGTAATGGGAAGTAGAATTGTGTGTTATGAAGCCA

Features of the protein sequence

Length: 353 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5MNZ6 5.3e-157 100.0 WD repeat domai...
Homo sapiens
AAI19891 1.7e-156 99.1 WDR45-like [Bos...
Bos taurus
Q5R7W0 3.2e-156 99.7 WD repeat domai...
Pongo abelii
Q9CR39 9.8e-156 99.1 WD repeat domai...
Mus musculus
BAE30843 3.6e-155 98.8 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001680 183 223 SM00320 WD40 repeat
IPR001680 226 267 SM00320 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp