ORK02374

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02374

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02374
Clone name	fk07246
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RFX4
cDNA sequence	DNA sequence (3751 bp) Predicted protein sequence (796 aa)
HaloTag ORF Clone	FHC02374
Flexi ORF Clone	FXC02374
Description	regulatory factor X4 isoform c

Features of the cloned cDNA sequence

Description

Length: 3751 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1333 bp
Genome contig ID	gi89161190f_105401074
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGGTTTCACACTCAAATAAAAAATATTGAAACG
Flanking genome sequence (279638 - 279687)	----+--------+--------+--------+--------+----* ACCTGCTTTCTTTTGACTTTTCATTTGACATGACCTGTGTGTGTGTGTGT

Features of the protein sequence

Description

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001161753	9.7e-177	94.9	regulatory fact...	Pan troglodytes
XP_001161665	9.7e-177	93.6	regulatory fact...	Pan troglodytes
AAH30644	1e-176	91.4	Regulatory fact...	Homo sapiens
XP_001161826	1.1e-176	95.8	regulatory fact...	Pan troglodytes
EAW97782	1.1e-176	95.9	regulatory fact...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003150	135	217	PF02257	DNA-binding RFX

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	30	LFFPLFFLFFSFPPLSLCPLTFC	52	PRIMARY	23