Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02527
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02527
Clone name ef06345
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MED20
cDNA sequence DNA sequence (2439 bp)
Predicted protein sequence (239 aa)
Flexi ORF Clone FXC02527
Description mediator complex subunit 20
Features of the cloned cDNA sequence

Length: 2439 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1717 bp
Genome contig ID gi89161210r_41881152
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGATATAGTTTACAAAAATAAAACGCACAGATCTT
Flanking genome sequence
(99919 - 99870)
----+----*----+----*----+----*----+----*----+----*
ACCTTTTTGGCCTCCTGATTTACATTTGCTCTCGTCCAGGTTTATTTATT

Features of the protein sequence

Length: 239 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H944 2.1e-95 100.0 Mediator of RNA...
Homo sapiens
Q4R4S8 4.9e-95 99.5 Mediator of RNA...
Macaca fascicularis
AAI46259 2.2e-94 98.5 MED20 protein [...
Bos taurus
Q5XIE9 2.7e-94 98.1 Mediator of RNA...
Rattus norvegicus
XP_001501272 7.3e-94 98.1 similar to Medi...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013921 28 226 PF08612 TATA-binding related factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp