Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02588
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02588
Clone name bm02547
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol BLZF1
cDNA sequence DNA sequence (2509 bp)
Predicted protein sequence (403 aa)
Flexi ORF Clone FXC02588
Description basic leucine zipper nuclear factor 1
Features of the cloned cDNA sequence

Length: 2509 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1119 bp
Genome contig ID gi89161185f_167504068
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTAGTTTTCAAGTGGCAATAAATTTATCTACCTTC
Flanking genome sequence
(120097 - 120146)
----+----*----+----*----+----*----+----*----+----*
TTTATTGCGACTATTCCTTTTTTCCCCCAGAATTAGTGCTTTGGTTTAGG

Features of the protein sequence

Length: 403 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H2G9 7.5e-149 100.0 Golgin-45; Basi...
Homo sapiens
BAF84414 1.5e-148 99.7 unnamed protein...
Homo sapiens
AAG37822 1.5e-148 99.7 leucine zipper ...
Homo sapiens
BAD97253 3.5e-148 99.7 basic leucine z...
Homo sapiens
XP_524957 9.5e-148 99.2 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013183 184 230 PF08227 Protein of unknown function DUF1721
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp