Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02697
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02697
Clone name bn04723
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol YEATS4
cDNA sequence DNA sequence (1384 bp)
Predicted protein sequence (270 aa)
Flexi ORF Clone FXC02697
Description YEATS domain containing 4
Features of the cloned cDNA sequence

Length: 1384 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 479 bp
Genome contig ID gi89161190f_67939799
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CAGTAAGTATTCAATAAATGTAGTTTACAGATCCT
Flanking genome sequence
(131045 - 131094)
----+----*----+----*----+----*----+----*----+----*
ATTTCTCCCTCCTGATGTGTTTCTTCCTCTTTGAAGACTTTCTGGAACTC

Features of the protein sequence

Length: 270 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O95619 6.8e-91 100.0 YEATS domain-co...
Homo sapiens
Q9CR11 1.5e-90 99.5 YEATS domain-co...
Mus musculus
XP_001362643 3.2e-90 99.1 hypothetical pr...
Monodelphis dom...
AAI09627 3.7e-90 99.1 YEATS domain co...
Bos taurus
XP_002190655 8e-90 98.2 YEATS domain co...
Taeniopygia guttata
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005033 87 169 PF03366 YEATS
ProfileScan IPR005033 65 169 PS51037 YEATS
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp