Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02720
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02720
Clone name ee10584
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RNF4
cDNA sequence DNA sequence (2893 bp)
Predicted protein sequence (224 aa)
Flexi ORF Clone FXC02720
Description ring finger protein 4
Features of the cloned cDNA sequence

Length: 2893 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2034 bp
Genome contig ID gi89161207f_2340655
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGTTACAGATGGAAATAAAACCATTAATTTGAACC
Flanking genome sequence
(146726 - 146775)
----+----*----+----*----+----*----+----*----+----*
AAATATCTTTTACACATTCATTTGCTCTTTGGAATCAATTTCCCCCCTTT

Features of the protein sequence

Length: 224 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P78317 4.5e-74 100.0 RING finger pro...
Homo sapiens
EAW82524 4.9e-73 98.9 ring finger pro...
Homo sapiens
XP_001118472 2.7e-72 98.9 similar to RING...
Macaca mulatta
XP_001489231 1.1e-70 94.7 similar to ring...
Equus caballus
ABB53639 7.8e-70 93.6 ring finger pro...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 166 210 PF00097 Zinc finger
HMMSmart IPR001841 166 210 SM00184 Zinc finger
ProfileScan IPR001841 166 211 PS50089 Zinc finger
ScanRegExp IPR001841 188 197 PS00518 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp