Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02723
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02723
Clone name ee16374
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF146
cDNA sequence DNA sequence (3305 bp)
Predicted protein sequence (314 aa)
Flexi ORF Clone FXC02723
Description zinc finger protein 146
Features of the cloned cDNA sequence

Length: 3305 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1457 bp
Genome contig ID gi42406306f_41311508
PolyA signal sequence
(ATTAAA,-33)		 
+----*----+----*----+----*----+----
TTATTAAAATTTAAAAGGACAGCACAAAAAAAAAC
Flanking genome sequence
(110012 - 110061)		 
----+----*----+----*----+----*----+----*----+----*
TGTTTTAATTATTTTAACATGGCATACACACTATATCGGGGTCCCCAGCT

Features of the protein sequence

Length: 314 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001494069 4e-132 98.3 similar to ozf,...
 Equus caballus
XP_001789583 1.2e-130 96.1 similar to ozf,...
 Bos taurus
CAA57406 1.7e-130 95.2 ozf [Bos taurus].
 Bos taurus
XP_874508 6.4e-130 95.8 similar to Zinc...
 Bos taurus
CAA49844 3.4e-126 100.0 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 38 60 PD000003 Zinc finger
IPR007087 66 89 PD000003 Zinc finger
IPR007087 94 117 PD000003 Zinc finger
IPR007087 122 145 PD000003 Zinc finger
IPR007087 150 172 PD000003 Zinc finger
IPR007087 178 201 PD000003 Zinc finger
IPR007087 206 229 PD000003 Zinc finger
IPR007087 234 257 PD000003 Zinc finger
IPR007087 262 285 PD000003 Zinc finger
IPR007087 290 313 PD000003 Zinc finger
HMMPfam IPR007087 38 60 PF00096 Zinc finger
IPR007087 66 88 PF00096 Zinc finger
IPR007087 94 116 PF00096 Zinc finger
IPR007087 122 144 PF00096 Zinc finger
IPR007087 150 172 PF00096 Zinc finger
IPR007087 178 200 PF00096 Zinc finger
IPR007087 206 228 PF00096 Zinc finger
IPR007087 234 256 PF00096 Zinc finger
IPR007087 262 284 PF00096 Zinc finger
IPR007087 290 312 PF00096 Zinc finger
HMMSmart IPR015880 38 60 SM00355 Zinc finger
IPR015880 66 88 SM00355 Zinc finger
IPR015880 94 116 SM00355 Zinc finger
IPR015880 122 144 SM00355 Zinc finger
IPR015880 150 172 SM00355 Zinc finger
IPR015880 178 200 SM00355 Zinc finger
IPR015880 206 228 SM00355 Zinc finger
IPR015880 234 256 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 290 312 SM00355 Zinc finger
ProfileScan IPR007087 38 65 PS50157 Zinc finger
IPR007087 66 93 PS50157 Zinc finger
IPR007087 94 121 PS50157 Zinc finger
IPR007087 122 149 PS50157 Zinc finger
IPR007087 150 177 PS50157 Zinc finger
IPR007087 178 205 PS50157 Zinc finger
IPR007087 206 233 PS50157 Zinc finger
IPR007087 234 261 PS50157 Zinc finger
IPR007087 262 289 PS50157 Zinc finger
IPR007087 290 314 PS50157 Zinc finger
ScanRegExp IPR007087 40 60 PS00028 Zinc finger
IPR007087 68 88 PS00028 Zinc finger
IPR007087 96 116 PS00028 Zinc finger
IPR007087 124 144 PS00028 Zinc finger
IPR007087 152 172 PS00028 Zinc finger
IPR007087 180 200 PS00028 Zinc finger
IPR007087 208 228 PS00028 Zinc finger
IPR007087 236 256 PS00028 Zinc finger
IPR007087 264 284 PS00028 Zinc finger
IPR007087 292 314 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp