ORK02801

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02801

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02801
Clone name	fk04732
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RFX5
cDNA sequence	DNA sequence (3558 bp) Predicted protein sequence (646 aa)
HaloTag ORF Clone	FHC02801
Flexi ORF Clone	FXC02801
Description	regulatory factor X, 5 (influences HLA class II expression)

Features of the cloned cDNA sequence

Description

Length: 3558 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1545 bp
Genome contig ID	gi89161185r_149479858
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CCATAACACATATACATTAAAACATTTTAAATACC
Flanking genome sequence (99883 - 99834)	----+--------+--------+--------+--------+----* ATTGTGTTTGTGTTCCTCCCTAGCCTGTCCCCCGCCTCTTCTTAGCGGTA

Features of the protein sequence

Description

Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P48382	1e-200	100.0	DNA-binding pro...	Homo sapiens
BAG35216	2e-200	99.8	unnamed protein...	Homo sapiens
BAD97246	5.2e-200	99.6	regulatory fact...	Homo sapiens
XP_001171715	7.3e-200	99.5	regulatory fact...	Pan troglodytes
CAH89811	6e-194	99.6	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003150	106	188	PF02257	DNA-binding RFX

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp