Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02822
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02822
Clone name hg02209
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MKKS
cDNA sequence DNA sequence (1803 bp)
Predicted protein sequence (572 aa)
Flexi ORF Clone FXC02822
Description McKusick-Kaufman syndrome
Features of the cloned cDNA sequence

Length: 1803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 55 bp
Genome contig ID gi51511747r_10233840
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ACAAGAGAAACAAATAAACTAGTCTGTTGGCAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGAAAAATTGTGAGTGTATTTGTTTTCTCCCAAAGCCCTGTTCTACATA

Features of the protein sequence

Length: 572 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NPJ1 0 100.0 McKusick-Kaufma...
Homo sapiens
AAH28973 0 99.6 McKusick-Kaufma...
Homo sapiens
XP_514516 0 98.9 hypothetical pr...
Pan troglodytes
BAB15230 0 99.1 unnamed protein...
Homo sapiens
Q5R4T7 0 98.2 McKusick-Kaufma...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002423 31 572 PF00118 Chaperonin Cpn60/TCP-1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp