Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02972
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02972
Clone name ee19715
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MED16
cDNA sequence DNA sequence (3029 bp)
Predicted protein sequence (872 aa)
Flexi ORF Clone FXC02972
Description Thyroid hormone receptor-associated protein complex 95 kDa component (Trap95) (Thyroid hormone receptor-associated protein 5) (Vitamin D3 receptor-interacting protein complex component DRIP92).
Features of the cloned cDNA sequence

Length: 3029 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 409 bp
Genome contig ID gi42406306r_718964
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GGGAAGGACAGGTCCAATAAACGCCCTCTGCGCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGCCCGCGTCCCTGCCGTCGGTGCCCCCGACCCCACCCACGACCTCGAT

Features of the protein sequence

Length: 872 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH04554 0 100.0 MED16 protein [...
Homo sapiens
Q9Y2X0 0 100.0 Mediator of RNA...
Homo sapiens
AAD30032 0 99.7 thyroid hormone...
Homo sapiens
XP_542212 0 94.5 similar to thyr...
Canis lupus fam...
EDL89372 0 90.6 thyroid hormone...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 102 140 PF00400 WD40 repeat
HMMSmart IPR001680 100 140 SM00320 WD40 repeat
ProfileScan IPR001680 108 141 PS50082 WD40 repeat
IPR001680 108 149 PS50294 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp