ORK03164

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03164

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03164
Clone name	hk07496
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PHKB
cDNA sequence	DNA sequence (4368 bp) Predicted protein sequence (1091 aa)
HaloTag ORF Clone	FHC03164
Flexi ORF Clone	FXC03164
Description	Phosphorylase b kinase regulatory subunit beta (Phosphorylase kinase subunit beta).

Features of the cloned cDNA sequence

Description

Length: 4368 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	982 bp
Genome contig ID	gi51511732f_45952754
PolyA signal sequence (None)	+--------+--------+----*----+---- ACACCAGCCTGGGTGACAGAGCGAGACTCCATCTC
Flanking genome sequence (339008 - 339057)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAAAAAGAAAAAAATATGTTAAATTTAAGGAC

Features of the protein sequence

Description

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH33657	99.9	Phosphorylase k...	Homo sapiens
XP_001162398	99.8	phosphorylase k...	Pan troglodytes
XP_001113940	99.2	phosphorylase k...	Macaca mulatta
XP_001113961	99.4	phosphorylase k...	Macaca mulatta
CAH92607	99.2	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008734	22	1090	PF05682	Phosphorylase kinase alphabeta

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp