ORK03165

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03165

Order Kazusa clone(s) from :

Accession No	AB290176
Product ID	ORK03165
Clone name	ff02556y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO1B
cDNA sequence	DNA sequence (5107 bp) Predicted protein sequence (1225 aa)
HaloTag ORF Clone	FHC03165
Flexi ORF Clone	FXC03165
Description	Myosin-Ib (Myosin I alpha) (MMI-alpha) (MMIa) (MYH-1c).

Features of the cloned cDNA sequence

Description

Length: 5107 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1424 bp
Genome contig ID	gi89161199f_191718362
PolyA signal sequence (CATAAA,-17)	+--------+--------+----*----+---- ATTTTTAAAAATTGCTCACATAAAGAAGTTCTCAG
Flanking genome sequence (279995 - 280044)	----+--------+--------+--------+--------+----* AAGTCTTTGTGTTTATTGGTGCAGGTAGAGGATGTAATTACTTAGATTCT

Features of the protein sequence

Description

Length: 1225 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43795	100.0	Myosin-Ib; Myos...	Homo sapiens
XP_001502293	98.9	similar to Myos...	Equus caballus
XP_848424	98.5	similar to Myos...	Canis lupus fam...
AAH54786	97.8	Myo1b protein [...	Mus musculus
AAI47927	98.0	MYO1B protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	229	258	PD000355	Myosin head
FPrintScan	IPR001609	134	153	PR00193	Myosin head
	IPR001609	190	215	PR00193	Myosin head
	IPR001609	236	263	PR00193	Myosin head
	IPR001609	471	499	PR00193	Myosin head
	IPR001609	524	552	PR00193	Myosin head
HMMPfam	IPR001609	106	777	PF00063	Myosin head
	IPR000048	794	814	PF00612	IQ calmodulin-binding region
	IPR000048	840	860	PF00612	IQ calmodulin-binding region
	IPR000048	869	889	PF00612	IQ calmodulin-binding region
	IPR010926	1029	1225	PF06017	Myosin tail 2
HMMSmart	IPR001609	98	791	SM00242	Myosin head
	IPR000048	792	814	SM00015	IQ calmodulin-binding region
	IPR000048	815	837	SM00015	IQ calmodulin-binding region
	IPR000048	838	860	SM00015	IQ calmodulin-binding region
	IPR000048	867	889	SM00015	IQ calmodulin-binding region
	IPR000048	896	918	SM00015	IQ calmodulin-binding region
	IPR000048	925	947	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	793	820	PS50096	IQ calmodulin-binding region
	IPR000048	839	867	PS50096	IQ calmodulin-binding region
	IPR000048	869	897	PS50096	IQ calmodulin-binding region
	IPR000048	897	926	PS50096	IQ calmodulin-binding region
	IPR000048	926	955	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp