ORK03169

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03169

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03169
Clone name	pf10182
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TNS3
cDNA sequence	DNA sequence (7508 bp) Predicted protein sequence (1528 aa)
HaloTag ORF Clone	FHC03169
Flexi ORF Clone	FXC03169
Description	tensin 3

Features of the cloned cDNA sequence

Description

Length: 7508 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2920 bp
Genome contig ID	gi89161213r_47181279
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTCTATTCAGAGTATAATAAAATTATGAACTTGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCTCCGTGAGACGGTATTTGTGTACCCTGAAGTATGTTTGTGTGTGT

Features of the protein sequence

Description

Length: 1528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW61012	99.9	tensin 3, isofo...	Homo sapiens
Q68CZ2	100.0	Tensin-3; Tumor...	Homo sapiens
AAN32667	99.8	tensin 3 [Homo ...	Homo sapiens
CAH18438	99.7	hypothetical pr...	Homo sapiens
XP_001054328	82.3	similar to tens...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	1255	1364	PD000093	SH2 motif
FPrintScan	IPR002219	-1	13	PR00008	Protein kinase C
	IPR002219	17	26	PR00008	Protein kinase C
	IPR002219	27	38	PR00008	Protein kinase C
	IPR002219	39	51	PR00008	Protein kinase C
HMMPfam	IPR002219	4	53	PF00130	Protein kinase C
	IPR000980	1255	1350	PF00017	SH2 motif
	IPR013625	1393	1527	PF08416	Tensin phosphotyrosine-binding domain
HMMSmart	IPR002219	4	50	SM00109	Protein kinase C
	IPR003595	147	269	SM00404	Protein-tyrosine phosphatase
	IPR000980	1253	1356	SM00252	SH2 motif
	IPR006020	1389	1526	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR002219	3	50	PS50081	Protein kinase C
	IPR014019	81	253	PS51181	Phosphatase tensin type
	IPR000387	186	242	PS50056	Protein-tyrosine phosphatase
	IPR014020	258	384	PS51182	C2 tensin-type
	IPR000980	1255	1365	PS50001	SH2 motif
ScanRegExp	IPR002219	4	50	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp