Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03172
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03172
Clone name ah02678
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TACC1
cDNA sequence DNA sequence (5337 bp)
Predicted protein sequence (810 aa)
Flexi ORF Clone FXC03172
Description Transforming acidic coiled-coil-containing protein 1 (Taxin 1) (Gastric cancer antigen Ga55).
Features of the cloned cDNA sequence

Length: 5337 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2753 bp
Genome contig ID gi51511724f_38664041
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCACTCCATCCTGGGTGACAGCAAGATCTTGTCTC
Flanking genome sequence
(163411 - 163460)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAACCAGGAGTGAAAAAGGAAAGTAGAA

Features of the protein sequence

Length: 810 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH91814 2.1e-180 97.8 hypothetical pr...
Pongo abelii
XP_001171527 2.3e-162 92.9 transforming, a...
Pan troglodytes
O75410 5.1e-161 94.9 Transforming ac...
Homo sapiens
AAC32327 7.4e-161 94.8 TACC1 [Homo sap...
Homo sapiens
XP_001171659 6.2e-159 94.4 transforming, a...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007707 601 808 PF05010 Transforming acidic coiled-coil-containing
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp