Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03180
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03180
Clone name bm04087
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CITED2
cDNA sequence DNA sequence (1915 bp)
Predicted protein sequence (346 aa)
Flexi ORF Clone FXC03180
Description Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Features of the cloned cDNA sequence

Length: 1915 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 873 bp
Genome contig ID gi89161210r_139635088
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTTAATTTGCCAATGTCAATAAAAAGTTAAGAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTGTTTTCTAGAAGTCATTTGGGGGTGGTTGTTCCCTTTGGTGGCTT

Features of the protein sequence

Length: 346 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q99967 4.2e-89 100.0 Cbp/p300-intera...
Homo sapiens
AAX29086 4.2e-89 100.0 Cbp/p300-intera...
synthetic construct
XP_518770 1.2e-87 98.1 Cbp/p300-intera...
Pan troglodytes
XP_850158 1.3e-86 96.3 similar to Cbp/...
Canis lupus fam...
XP_001925809 1.9e-86 96.7 similar to Cbp/...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007576 116 346 PF04487 CITED
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp