ORK03199

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03199

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03199
Clone name	hk07120
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IER2
cDNA sequence	DNA sequence (4343 bp) Predicted protein sequence (253 aa)
HaloTag ORF Clone	FHC03199
Flexi ORF Clone	FXC03199
Description	immediate early response 2

Features of the cloned cDNA sequence

Description

Length: 4343 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1044 bp
Genome contig ID	gi42406306f_13022375
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GAAATGTCAGATAGGAAAATAAAAACCATTTGAGT
Flanking genome sequence (104343 - 104392)	----+--------+--------+--------+--------+----* AAAAAAGCCGGTGCTGTCTGGTTTTCTGCTGTGGTGGGGGAGGGGCGGGG

Features of the protein sequence

Description

Length: 253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BTL4	2.2e-75	100.0	Immediate early...	Homo sapiens
AAX42658	2.2e-75	100.0	immediate early...	synthetic construct
AAX36710	4.8e-75	99.5	immediate early...	synthetic construct
AAA35814	8e-75	99.1	ETR101 [Homo sa...	Homo sapiens
XP_001110964	3e-73	98.2	similar to imme...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008653	31	253	PF05760	Immediate early response

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp