ORK03296

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03296

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03296
Clone name	hh03581
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CREBL2
cDNA sequence	DNA sequence (5800 bp) Predicted protein sequence (138 aa)
HaloTag ORF Clone	FHC03296
Flexi ORF Clone	FXC03296
Description	cAMP responsive element binding protein-like 2

Features of the cloned cDNA sequence

Description

Length: 5800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5177 bp
Genome contig ID	gi89161190f_12556114
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGCAAGACTCTGTCTC
Flanking genome sequence (135265 - 135314)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAACTGAGACTGGGTAG

Features of the protein sequence

Description

Length: 138 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60519	1.2e-43	100.0	cAMP-responsive...	Homo sapiens
XP_853938	3.1e-43	99.1	similar to cAMP...	Canis lupus fam...
Q0VD32	7.6e-43	98.3	cAMP-responsive...	Bos taurus
EDM01649	7.1e-42	97.4	cAMP responsive...	Rattus norvegicus
Q5BJU6	7.3e-42	97.4	cAMP-responsive...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011700	42	93	PF07716	Basic leucine zipper

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp