ORK04020

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04020

Order Kazusa clone(s) from :

Accession No	AB209538
Product ID	ORK04020
Clone name	fk11295
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ACAD8
cDNA sequence	DNA sequence (3316 bp) Predicted protein sequence (263 aa)
Description	Acyl-CoA dehydrogenase family member 8, mitochondrial precursor (EC 1.3.99.-) (ACAD-8) (Isobutyryl-CoA dehydrogenase) (Activator- recruited cofactor 42 kDa component) (ARC42).

Features of the cloned cDNA sequence

Description

Length: 3316 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2524 bp
Genome contig ID	gi51511727f_133531687
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTGGAATAATAAAACTCTCGTCCAATTTGGCTTTT
Flanking genome sequence (109269 - 109318)	----+--------+--------+--------+--------+----* AAAAAGCAGGCTCCTTAAATTATTAATAACTTTGCAAACTAAGCATTGTT

Features of the protein sequence

Description

Length: 263 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92775	1.1e-117	100.0	acyl-Coenzyme A...	Homo sapiens
1RX0	2.3e-102	100.0	Acyl-CoA dehydr...	Homo sapiens
Q9UKU7	2.3e-102	100.0	Isobutyryl-CoA ...	Homo sapiens
XP_508872	1.4e-101	98.7	acyl-Coenzyme A...	Pan troglodytes
AAH01964	2.1e-101	99.5	Acyl-Coenzyme A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006092	1	105	PF02771	Acyl-CoA dehydrogenase
	IPR006091	109	160	PF02770	Acyl-CoA dehydrogenase/oxidase
	IPR006090	215	240	PF00441	Acyl-CoA dehydrogenase
ScanRegExp	IPR006089	111	123	PS00072	Acyl-CoA dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp