ORK04021

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04021

Order Kazusa clone(s) from :

Accession No	AB209427
Product ID	ORK04021
Clone name	ph00421
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ACAD9
cDNA sequence	DNA sequence (5578 bp) Predicted protein sequence (274 aa)
Description	Acyl-CoA dehydrogenase family member 9, mitochondrial precursor (EC 1.3.99.-) (ACAD-9).

Features of the cloned cDNA sequence

Description

Length: 5578 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2708 bp
Genome contig ID	gi89161205f_129981176
PolyA signal sequence (TATAAA,-28)	+--------+--------+----*----+---- CAAAGAATATAAAATGTCACAATCTGTGTACTGTT
Flanking genome sequence (133472 - 133521)	----+--------+--------+--------+--------+----* AGCCTTTGCTGTACTTGTCACACTGTTCCTTAGAACCAGCCTTTAATGGG

Features of the protein sequence

Description

Length: 274 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92664	2.1e-110	100.0	acyl-Coenzyme A...	Homo sapiens
AAL56011	3.1e-107	100.0	very-long-chain...	Homo sapiens
Q9H845	3.1e-107	100.0	Acyl-CoA dehydr...	Homo sapiens
XP_001096856	3.8e-105	97.3	similar to acyl...	Macaca mulatta
BAE87585	4.1e-105	97.0	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006092	15	123	PF02771	Acyl-CoA dehydrogenase
	IPR006091	127	180	PF02770	Acyl-CoA dehydrogenase/oxidase
	IPR006090	240	271	PF00441	Acyl-CoA dehydrogenase
ScanRegExp	IPR006089	129	141	PS00072	Acyl-CoA dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp