Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04031
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209248
Product ID ORK04031
Clone name fj18325
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ACP6
cDNA sequence DNA sequence (4567 bp)
Predicted protein sequence (313 aa)
Description Lysophosphatidic acid phosphatase type 6 precursor (EC 3.1.3.2) (Acid phosphatase 6, lysophosphatidic) (Acid phosphatase-like protein 1) (PACPL1).
Features of the cloned cDNA sequence

Length: 4567 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3514 bp
Genome contig ID gi89161185r_145485794
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTGTTGATTTTAAAATAAAGTGCCTTTATACAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTCCTGCTTTGTGTGTTTGGGAAGAGGAGAGAGCAAGGGGTAATGTACT

Features of the protein sequence

Length: 313 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92485 1.2e-135 100.0 acid phosphatas...
Homo sapiens
XP_513753 1.7e-128 97.7 hypothetical pr...
Pan troglodytes
XP_001099057 3.8e-123 94.1 similar to acid...
Macaca mulatta
Q9NPH0 3e-109 98.1 Lysophosphatidi...
Homo sapiens
CAI15199 3e-109 98.1 acid phosphatas...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000560 91 313 PF00328 Histidine acid phosphatase
ScanRegExp IPR000560 92 106 PS00616 Histidine acid phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp