Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04053
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209810
Product ID ORK04053
Clone name bm04182
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ADD3
cDNA sequence DNA sequence (2250 bp)
Predicted protein sequence (699 aa)
Description Gamma-adducin (Adducin-like protein 70).
Features of the cloned cDNA sequence

Length: 2250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161187f_111655769
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
AGAAATTCCGCACTCCTTCTTTTCTGAAAAAGAAC
Flanking genome sequence
(227572 - 227621)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGGAGAAAGTTGAGGCCTAAATAAAGTCTTTTTATAATTATTA

Features of the protein sequence

Length: 699 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93047 0 100.0 adducin 3 isofo...
 Homo sapiens
Q9UEY8 0 100.0 Gamma-adducin; ...
 Homo sapiens
XP_001141198 0 99.7 adducin 3 (gamm...
 Pan troglodytes
XP_001141367 0 98.7 adducin 3 (gamm...
 Pan troglodytes
XP_001141615 0 98.7 adducin 3 (gamm...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001303 140 339 PF00596 Class II aldolase/adducin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp